scnn1a tg3 cre mice jackson laboratory rrid imsr jax (Jackson Laboratory)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Jackson Laboratory scnn1a tg3 cre mice jackson laboratory rrid imsr jax
Scnn1a Tg3 Cre Mice Jackson Laboratory Rrid Imsr Jax, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jackson+laboratory+jax/cre+mice+scnn1a+tg3/pm42248694-52-224-226
Average 86 stars, based on 1 article reviews

scnn1a tg3 cre mice jackson laboratory rrid imsr jax - by Bioz Stars, 2026-09

86/100 stars

Images

other:

Article Title: Sensory neurons shape local macrophage identity via TGF-β signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Transferrin Sigma Aldrich Cat# T8158 Triton X-100 Sigma-Aldrich Cat# 93418 Tween 20 Sigma-Aldrich Cat# P2287 Y-27632 Tocris Cat# 1254 Critical commercial assays ABsolute qPCR SYBR Green Thermo Fisher Scientific Cat# AB1159A BD CytofixTM Fixation Buffer BD Biosciences Cat# 554655 BD PhosflowTM Perm Buffer III BD Biosciences Cat# 558050 LEGENDplex-kit Biolegend Cat# 740677 RNAeasy Micro Kit QIAGEN Cat# 74004 SuperscriptTM IV VILOTM Master Mix Thermo Fisher Scientific Cat# 11756050 TGF-β1 ELISA R&D Systems Cat# DY1679 Trifecta siRNA Kit, Tgfb1 Trifecta mm.Ri.Tgfb1.13 Deposited data Bulk RNAseq of dermal macrophages in homeostasis and after injury This paper GEO: GSE250457 Bulk RNAseq of co-cultured BMDMs This paper GEO: GSE250457 scRNAseq of murine DRG Sharma et al. 27 GEO: GSE19088 scRNAseq of human DRG Tavares-Ferreira et al. 28 N/A scRNAseq of human skin donors Steele et al. 29 N/A Bulk RNAseq of CGRP-treated BMDM Lu et al. 24 GEO: GSE255049 Microarray data of mouse dermal macrophages Kolter et al. 6 GEO: GSE114526 Experimental models: Cell lines iPSC cell line LVPC118 Jung et al. 52 N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Mouse: B6(Cg)-Cxcr4tm1.1(cre/ERT2)Stum/J The Jackson Laboratory JAX: 40559 Mouse: B6.129(Cg)-Scn10atm2(cre)Jwo/TjpJ The Jackson Laboratory JAX: 036564 Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J Steffen Jung (Israel) Yona et al. 38 Mouse: B6.129P2(Cg)-Cx3cr1tm1Litt/J Steffen Jung (Israel) Yona et al. 38 Mouse: B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J The Jackson Laboratory JAX: 006148 Mouse: B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato) Hze/J The Jackson Laboratory JAX: 007909 Mouse: B6;129-Tgfbr2tm1Karl/J The Jackson Laboratory JAX:012603 Mouse: C57BL/6J-Tgfb1em2Lutzy/Mmjax The Jackson Laboratory JAX:065809 Mouse: Mrc1-cre/ERT2 x B6.Cg-Gt(ROSA)26Sortm9 (CAG-tdTomato)Hze/J Marco Prinz (Freiburg) Masuda et al. 18 Oligonucleotides Primers for qRT-PCR, see methods This paper N/A Software and algorithms Fiji 1.47v ImageJ https://fiji.sc/ Imaris v10.1.1 Bitplane https://imaris.oxinst.com Kaluza v2.1 Beckman Coulter https://www.beckman.de/flow-cytometry/ software/kaluza Panther v18.0 Paul Thomas http://www.pantherdb.org/ Prism v9.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ R v4.3.1 The R foundation https://www.r-project.org/ ZEN 3.0 Zeiss https://www.zeiss.de/mikroskopie/produkte/ mikroskopsoftware/zen.html Immunity 58, 1–18.e1–e8, October 14, 2025 e3

RNA Sequencing:

Article Title: In vitro protocol demonstrating five functional steps of trained immunity in mice: Implications on biomarker discovery and translational research.
Article Snippet: LIVE/DEADTM Fixable Blue Thermo Fisher Scientific Cat#L23105 Critical commercial assays EasySep Mouse Monocyte Isolation Kit Stem Cell Technologies Cat# 19861 IL-6 Mouse Uncoated ELISA Kit Thermo Fisher Scientific Cat#88-7064-88 TNF alpha Mouse Uncoated ELISA Kit Thermo Fisher Scientific Cat#88-7324-88 Mouse CXCL10/IP-10/CRG-2 DuoSet ELISA R&D Systems Cat#DY466 ELLA SimplePlex mouse IL6, Bio-thechne SPCKB-MP-000466 ELLA SimplePlex mouse TNF Bio-thechne SPCKB-MP-000822 ELLA SimplePlex mouse CXCL10 Bio-thechne SPCKB-MP-001485 Mouse SAA-3 ELISA Merck Cat#EZMSAA3-12K Glycolysis Stress Test kit Agilent Cat#103020-100 Mito Stress Test kit Agilent Cat#103015-100 L-Lactate assay kit Abcam Cat#Ab65330 QubitTM dsDNA Quantification Assay Kits Thermo Fisher Scientific Cat#Q32851 NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina. .. New United Kingdom Biolabs Cat#E6420L Deposited data RNA sequencing data accession number This paper GSE290033 ATAC sequencing data accession number This paper GSE290032 Metabolomics DOI number This paper http://doi.org/10.21228/M8583B Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Mouse: B6.129S4-Mtortm1.2Koz/J The Jackson Laboratory JAX: 011009 Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J The Jackson Laboratory JAX: 004781 Mouse: BALB/cJ The Jackson Laboratory JAX: 000651 Software and algorithms FlowJo Software TreeStar https://www.flowjo.com GraphPad Prism v9.1 GraphPad software https://www.graphpad.com ImageJ https://imagej.nih.gov/ij/ Seahorse Wave Desktop Software Agilent https://www.agilent.com/en/product/ cell-analysis/real-time-cell-metabolicanalysis/xf-software Other RNA-seq and ATAC-seq data preprocessing and analysis This paper https://bings.mssm.edu/ Cell Reports 44, 116202, October 28, 2025 19 .. Murine bone marrow was collected and processed as previously described.36 Bone marrow monocytes were isolated by negative selection using the EasySep mouse monocyte isolation kit (StemCell Technologies, Vancouver, Canada) according to the manufacturer’s instructions.

Sequencing:

Software:

Recombinant:

Article Title: Hyperinnervation inhibits organ-level regeneration in mammalian skin.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase MilliporeSigma Cat#C2674 DAPI Sigma-Aldrich Cat#D9542 Donkey Serum MilliporeSigma Cat#D9663 DPBS without Calcium and Magnesium Thermo Fisher Scientific Cat#14-190-250 Eosin Thermo Fisher Scientific Cat#23-314631 Ethanol Sigma-Aldrich Cat#E7023 Ethyl cinnamate MilliporeSigma Cat#112372 Fetal Bovine Serum Atlanta Biologicals Cat#S12150 Fluoromount-G Mounting Medium SouthernBiotech Cat#0100-01 FluorSave Reagent MilliporeSigma Cat#345789 Gelatin from cold water fish skin Sigma-Aldrich Cat#G7765 Glycerol MilliporeSigma Cat#G7893 Glycine Sigma-Aldrich Cat#G8898 Hank’s Balanced Salt Solution, calcium, magnesium Thermo Fisher Scientific Cat#24020117 Harris Hematoxylin Solution Sigma-Aldrich Cat#HHS128 Henna ink Amazon Cat#B07PFBLVFG Histo-Clear II Electron Microscopy Sciences Cat#64111-04 Hydrochloric acid MilliporeSigma Cat#7647-01-0 Lipopolysaccharides from Escherichia coli O111:B4 Sigma-Aldrich Cat#L2630 Methanol Thermo Fisher Scientific Cat#A412SK-4 Power SYBR Green Thermo Fisher Scientific Cat#4367659 Scott’s Bluing Thermo Fisher Scientific Cat#6697-32 Sucrose Sigma-Aldrich Cat#S0389 Tissue-Tek OCT Sakura Cat#4583 Trichrome Stain (Masson) Kit Sigma-Aldrich Cat#HT15-1 Triton X-100 Electron Microscopy Sciences Cat#22140 TRIzol LS Reagent Thermo Fisher Scientific Cat#10296-028 Trypsin-EDTA (0.25%) Life Technologies Cat#25200-114 TWEEN 20 Sigma-Aldrich Cat#P9416 Veet Gel Hair Removal Cream Sensitive Amazon Cat#IU7 Xylene Thermo Fisher Scientific Cat#422680025 Critical commercial assays Qubit RNA HS Assay Kit Thermo Fisher Scientific Cat#Q32852 RNeasy Micro Kit Qiagen Cat#74004 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Bio Cat#323100 RNAscope Probe – Mm-Cxcl12 ACD Bio Cat#422711 SuperScript IV VILO Master Mix with ezDNase Enzyme Thermo Fisher Scientific Cat#11766050 ZymoPURE II Plasmid Purification Kit, Midiprep Zymo Research Cat#D4201 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: CCR2 KO (B6.129S4-Ccr2tm1Ifc/J) The Jackson Laboratory JAX:004999 Mouse: CD1 IGS Charles River CRL:002 Mouse: CD64-Cre Zhang et al.102 N/A Mouse: Cxcl12 fl/fl (B6(FVB)Cxcl12tm1.1Link/J) The Jackson Laboratory JAX:021773 (Continued on next page) ll OPEN ACCESS Cell 189, 1–17.e1–e7, May 28, 2026 e2 Please cite this article in press as: Tam et al., Hyperinnervation inhibits organ-level regeneration in mammalian skin, Cell (2026), https:// doi.org/10.1016/j.cell.2026.02.027 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Cxcr4 fl/fl (B6.129P2Cxcr4tm2Yzo/J) The Jackson Laboratory JAX:008767 Mouse: K14-Cre (B6N.Cg-Tg(KRT14cre)1Amc/J) The Jackson Laboratory JAX:018964 Mouse: Pdgfra-Cre (C57BL/6-Tg(Pdgfracre)1Clc/J) The Jackson Laboratory JAX:013148 Mouse: Pdgfra-H2BGFP (B6.129S4Pdgfratm11(EGFP)Sor/J) The Jackson Laboratory JAX:007669 Mouse: Timp1 fl/fl Sutter et al.103 N/A Mouse: Vglut2-Cre (Slc17a6tm2(cre)Lowl/ J) The Jackson Laboratory JAX:016963 Oligonucleotides Primer: β-actin forward (GGCTGTATTCCCCTCCATCG) This paper N/A Primer: β-actin reverse (CCAGTTGGTAACAATGCCATGT) This paper N/A Primer: Cxcr4 forward (GGGGTCATCAAGCAAGGATGT) This paper N/A Primer: Cxcr4 reverse (CATAGAGGATGGGGTTCAGGC) This paper N/A Primer: WPRE forward (CTGCTTTAATGCCTTTGTATCATGCTAT) This paper N/A Primer: WPRE reverse (CAACTCCTCATAAAGAGACAGCAACCA) This paper N/A Primer: β-actin forward (GGCTGTATTCCCCTCCATCG) This paper N/A Primer: β-actin reverse (CCAGTTGGTAACAATGCCATGT) This paper N/A Primer: Cxcr4 forward (GGGGTCATCAAGCAAGGATGT) This paper N/A Primer: Cxcr4 reverse (CATAGAGGATGGGGTTCAGGC) This paper N/A Primer: WPRE forward (CTGCTTTAATGCCTTTGTATCATGCTAT) This paper N/A Primer: WPRE reverse (CAACTCCTCATAAAGAGACAGCAACCA) This paper N/A Recombinant DNA pAAV-CAG-Ccl7-t2A-EGFP This paper N/A pAAV-CAG-Ccl8-t2A-EGFP This paper N/A pAAV-CAG-Clu-3xHA This paper N/A pAAV-CAG-Crispld2-3xHA This paper N/A pAAV-CAG-Cxcl12-t2A-EGFP This paper N/A pAAV-CAG-H2B-mCherry This paper N/A pAAV-CAG-Mmp19-3xHA This paper N/A pAAV-CAG-Ngf-t2A-EGFP This paper N/A pAAV-CAG-Sod3-t2A-EGFP This paper N/A pAAV-CAG-Spp1-t2A-EGFP This paper N/A pAAV-CAG-tdTomato Addgene Addgene:59462 pAAV-CAG-Timp1-t2A-mRFP This paper N/A pAAV-flex-taCasp3-TEVp Addgene Addgene:45580 pLV-GFP Addgene Addgene:25999 (Continued on next page) ll OPEN ACCESS e3 Cell 189, 1–17.e1–e7, May 28, 2026 Please cite this article in press as: Tam et al., Hyperinnervation inhibits organ-level regeneration in mammalian skin, Cell (2026), https:// doi.org/10.1016/j.cell.2026.02.027 Article .. CD1 mice were obtained from Charles River Laboratories.

Review